There are three steps needed to setup the Standalone BLAST
executable.

1) Download and compress the Standalone BLAST Windows binary
blastcz.exe. We suggest doing this in it's own directory, perhaps called
blast. This is a 'self-extracting' archive and all you need to do is run
this either through a Command Prompt (DOS Prompt) or by selecting "Run"
from the Windows "Start button" and browsing the blastcz.exe file.

2) Create an ncbi.ini file. In order for Standalone BLAST to operate,
you have will need to have an ncbi.ini file that contains the following
lines:[NCBI]
Data="C:\path\data\"

Where "C:path\data\" is the path to the location of the Standalone
BLAST "data" subdirectory. For example:

Data=C:\blast\data

This data subdirectory should automatically appear in the directory
where the downloaded file was extracted.

Make sure that your ncbi.ini file is in the Windows or WINNT directory
on your machine. Note: If you already have an ncbi.ini file on your
machine from installing other NCBI software(Network Entrez, Sequin etc.)
you can skip this section. However, if you see the following error
message, you should rename the old ncbi.ini file to something like
ncbi.bak and follow the instructions in number 2 above.

Abrupt: code=1
FATAL ERROR: FindPath failed.

C) The main advantage of Standalone BLAST is to be able to create your
own BLAST databases. This can be done with any file of FASTA formatted
protein or nucleotide sequences. If you are interested in creating your
own database you should refer to the sections "Non-redundant defline
syntax" and "Appendix 1: Sequence Identifier Syntax" of the README in
the BLAST database directory (ftp://ftp.ncbi.nih.gov/blast/db/). You can
also refer to the FASTA description available from the BLAST search
pages (http://www.ncbi.nlm.nih.gov/BLAST/fasta.html).

However, for a testing purposes you should download one of the NCBI
databases and run a search against it.

In the BLAST database FTP directory ftp://ftp.ncbi.nih.gov/blast/db/
you will find the downloadable BLAST database files. For your first
search we recommend downloading something relatively small like
ecoli.nt.Z (1349 Kb).  This is a FASTA formatted file of nucleotide
sequences which is also compressed. (If you do not have a copy of UNIX
"uncompress" for your Windows PC contact NCBI Info at
info@ncbi.nlm.nih.gov).

Once uncompressed, you will now need to format the database using the
'formatdb' program which comes with your Standalone BLAST executable.
The list of arguments for this program and all other BLAST programs are
located at the end of the README in the Standalone BLAST FTP directory
(ftp://ftp.ncbi.nih.gov/blast/executable/). Or you can get these
arguments by running each of the BLAST programs (formatdb, blastall
etc.) with a single hyphen as the argument (Example: formatdb -). For
this document we are just going to show you the basic commands for
formatting the database and running your first search.

To format the ecoli.nt database run the following from the command
line:

formatdb -i ecoli.nt -p F -o T

This will create seven index files that Standalone BLAST needs to
perform the searches and produce results. The ecoli.nt file can be
removed once formatdb has been run.

Next create a test nucleotide file to run against the new database.  It
may be easier to 'cheat' here and just extract a portion of a
nucleotide sequence you know is in the downloaded ecoli.nt database.
So  make a text file called test.txt with the following sequence:

>Test
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA
TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG
CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA
GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC
AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTG
AAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT

To run the first search just do the command:

blastall -p blastn -d ecoli.nt -i test.txt -o test.out

This should generate a results file called test.out in the Standalone
BLAST directory. Now you are ready to create your own databases and run
BLAST searches. For more information you should refer to the Standalone
BLAST README ( ftp://ftp.ncbi.nih.gov/blast/executable/) and the BLAST
literature.  This will give you some idea of all the programs BLAST
supports and the use of different parameters for increasing or
decreasing the stringency of your results.

If you have any questions please send them to the
blast-help@ncbi.nlm.nih.gov e-mail address.