187 Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

class Solution {
public:
    vector<string> findRepeatedDnaSequences(string s) {
        unordered_map<int, bool> m;
        vector<string> r;
        for (int t = 0, i = 0; i < s.size(); i++) {
            t = t << 3 & 0x3FFFFFFF | s[i] & 7;
            if (m.find(t) != m.end()) {
                if (m[t]) {
                    r.push_back(s.substr(i - 9, 10));
                    m[t] = false;
                }
            } else {
                m[t] = true;
            }
        }
        return r;
    }
};