Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

 

Analyse: Use a map to store all 10-letter-long sequences and count their times at the same time. Do a two-pass examination and put all sequences appear more than once in the result vector. 

class Solution {
public:
    vector<string> findRepeatedDnaSequences(string s) {
        vector<string> result;
        if(s.length() < 11) return result;
        
        unordered_map<string, int> um;
        for(int i = 0; i < s.size() - 9; i++){
            um[s.substr(i, 10)]++;
        }
        for(unordered_map<string, int>::iterator ite = um.begin(); ite != um.end(); ite++){
            if(ite->second > 1)
                result.push_back(ite->first);
        }
        return result;
    }
};